The new fantasy, p.18
The New Voices of Fantasy,
p.18
Where are you going? said the other ducks.
Nowhere, said the duck. Just around.
But the other ducks knew exactly where he was going and they all laughed at him behind his back.
Stupid duck is in love with a rock, they sniggered. Wonder what kind of ducklings they will have.
But there was one duck—a girl duck—who did not laugh. She had known the strange duck for a long time, and had always found him to be a good and decent bird. She felt sorry for him; it was hard luck to fall in love with a rock. She wanted to help, but what could she do? She trailed after the duck and watched him woo the rock from behind a tree.
I love you, the duck was saying. I love you I love you I love you. I love you more than the stars in the sky, I love you more than the fish in the river, I love you more than . . . more than. . . .
There he stopped, for he could think of nothing else that existed.
Life itself? said the girl duck from behind the tree. She hadn’t meant to pipe up. The words just sort of leapt out of her.
The duck spun around to look at her. He was terrified.
It’s okay, said the girl duck, waddling out from behind the tree. I know you’re in love with the rock. In fact, everyone knows.
They do? said the duck.
Yes, said the girl duck. Yes, they do.
The duck sighed and sat down on the ground. If he had had hands, he would have buried his head in them.
What am I going to do? he said. What am I going to do?
Do? the girl duck said.
How can it go on like this? said the duck. I love a thing that cannot speak, cannot move, cannot . . . I don’t even know how it feels about me!
The girl duck looked at the rock. She didn’t know what to say.
I know, said the duck. You think I’m crazy. You think it’s just a rock. But it isn’t just a rock; it’s different. It’s very different.
He looked at the rock.
But something has to happen, he said, and soon. Because my heart will break if this goes on much longer.
That night the girl duck had a hard time sleeping. She kept paddling around in circles, thinking about the rock and the duck and his heart that might break. She thought long and hard, and before morning she had an idea. She went and woke up the strange duck.
Things happen when they must, she said, as if it were an extremely meaningful statement.
So? said the duck.
So I have a plan, said the girl duck. And I think that it will work.
Well what is it? said the duck, nearly bursting with excitement.
We will need help, said the girl duck, and it will take some time. And also we will need a cliff.
Two days later they set out. It took four ducks to carry the rock. They worked in teams and traded off every fifteen minutes. Everyone joined in, even though they’d laughed, for ducks are all brothers when it comes right down to it.
The cliff is over that hill and then quite a ways to the south, said the most elderly duck. I remember flying over it when I was a fledgling. It looked like the edge of the world.
The ducks trudged on under their rocky weight for hours—for hours, and then for days. At night they camped under hedges and strange trees and ate beetles and frogs.
Do you think it will be much farther? said one of the ducks.
Maybe, said the oldest duck. My memory is not so good anymore.
On the sixth day, the ducks began to tire.
I don’t believe there is a cliff, said one of them.
Me neither, said another. I think the old duck is crazy.
My back hurts, said a third duck. I want to go home.
Me too, said a fourth. In fact, I’m going to.
And then all the ducks began to turn for home. The rock fell to the forest floor and lay there.
The strange duck looked imploringly at the girl duck.
Don’t worry, she said, I won’t leave you.
They watched all the other ducks flee homeward, and then they hoisted the rock onto their backs and trudged on.
What do you think will happen when we throw it off the cliff? said the duck.
I don’t know, said the girl duck. I just know it will be something.
Finally they came to the edge of the cliff. The drop-off was so great they couldn’t see the ground—just great white clouds spread out before them like an endless rolling cotton blanket.
It looks so soft, said the duck.
Yes it does, said the girl duck. Are you ready?
The duck looked at the rock.
This is it, my love, he said. The moment of truth. And whatever happens, please remember—always remember—I love you.
And the two ducks hurled the rock off the cliff together.
At first the rock simply fell. Like a rock, one might say. Like a stone.
But then something began to happen. It began to slow, it began to grow, it began to change. It narrowed, it elongated—and it also spread sideways.
It’s becoming a bird, the girl duck said.
And it was. It was becoming a beautiful gray bird—really not that unlike a duck. Its wings began to move slowly up and down, up and down, and it dove down and then coasted up. It looked back over its shoulder at the two ducks on the cliff, and it called out just once—Goodbye! And then it was going, going, getting smaller and smaller, flying off, over the blanket, across the sky.
The ducks did not speak much on the way home.
Do you think it will be happy? said the duck.
I hope so, said the girl duck, and that was all.
They really didn’t say any more.
When they reached the pond, the other ducks gathered around and clamored to hear what had happened. The duck and the girl duck glanced at each other.
Nothing, said the girl duck. It fell.
In the days that followed, the duck stayed to himself. The girl duck went and swam around in circles. She thought about that rocky bird flying off into the sky; she saw it over and over in her mind.
And then one day, not too many days later, she looked and saw the duck come swimming up. He was carrying a small salamander in his bill.
For me? the girl duck said.
And the duck smiled.
WING
Amal El-Mohtar
Amal El-Mohtar is a Canadian author of more than twenty stories of science fiction and fantasy and edits the poetry magazine Goblin Fruit. The Honey Month, a short collection of her stories, was published by the fine-arts publisher Papaveria Press in 2011 and republished the following year by Ann and Jeff VanderMeer’s Cheeky Frawg Books. She won the Locus Award in 2015 for her story “The Truth About Owls” and three Rhysling awards for her poetry, in 2009, 2011, and 2014. She has also been nominated for the Nebula, World Fantasy, and Aurora awards. Her stories have appeared in Shimmer, Strange Horizons, Lackington’s, Lightspeed, Uncanny, and most recently The Starlit Wood: New Fairy Tales. She lives in Ottawa.
“Wing” is a story about the idiosyncratic meaning of books and those who read them. It first appeared in Strange Horizons in 2013 and was reprinted in Rose Lemberg’s anthology An Alphabet of Embers with illustrations by M. Sereno.
In a cafe lit by morning, a girl with a book around her neck sits quietly at a table.
She reads—not the book around her neck, which is small, only as long and as wide as her thumb, black cord threaded through a sewn leather spine, knotted shut. She reads a book of maps and women, turns every page as if it were a lock of hair, gently. Every so often, her fingers stray to the book that sits above her sternum, twist it one way, then the other; every so often, she sips her tea.
“What is written in your book?” asks the man who brought her the tea. She looks up.
It is said, she reads, that a map drawn on a virgin’s skin creates a land on the other side of the moon. Whole civilisations rise, whole empires are built in the time it takes for bath water and scented soap to tear its minarets down, smash its aqueducts, strike its flying machines from the star-sewn sky. This is likely nonsense, but as no one has been to the other side of the moon, it remains entirely possible.
The man blushes, then frowns. “That’s nice,” he says, “but I meant in your book. The one you wear. What is written there?”
The girl’s lashes touch her cheeks. “A secret.”
He opens his mouth to ask another question, then shuts it. He walks away.
The girl with the book around her neck sits quietly beneath a chestnut tree.
She reads a book with a halved pomegranate on the cover, a wasp stamping its black feet in the juice. She turns every page as if she were lifting a veil, delicately. The sun is bright against the paper, makes the words swim green against her eyes.
Another girl comes by, her hair curly, her step light. She wears a bag over one shoulder, and sits down near the girl with the book around her neck. She smiles. The girl with the book around her neck smiles back. The girl with the bag pulls out a loaf of bread, a wedge of cheese, a small jar of amber honey, and a knife; she begins to slice, to pair, to drizzle honey on the lot.
“What are you reading?” she asks, curious.
Once, reads the girl, only once, for never has this happened since, nor is it likely to, a bird lit down on the head of a young man seated beneath a peach tree. The bird’s plumage was most fine, smooth as linen, bright as the afternoon sun drinking garden petals. The man could not gaze at it, but sat very still, so as not to disturb it; he closed his eyes, for even the barest flash of tail or pinion as it shifted about his scalp was painful to him, was too beautiful for his gaze. The bird whispered in his ear the secret to immortality, which involved the consumption of nectar, the building of a fire, and the bathing of his limbs in a sacred pool. So deep was the young man’s gratitude, so fierce was his love for the beautiful creature perched on his head, that his heart burst in his chest and he died on the spot.
The girl with the bag, who had begun to chew her honeyed cheese and bread, coughs a little as she laughs. She wipes her mouth modestly and offers the girl with the book around her neck a morsel of her own. She accepts it, and they munch together in silence. Then, as they are rubbing their fingers together to clean the honey from them, the girl with the bag asks, “What is written in the book around your neck?”
She blushes. “A secret.”
“Oh,” says the other girl. They spend a few more moments together, before the girl with the bag gathers up her effects, bids the girl with the book around her neck a kind farewell, and goes on her way.
The girl with the book around her neck sits quietly on a jutting rock by the sea.
The sea is not quiet; the sea is an angry choir of dissonant voices, all taking turns striking their rage against the shore. The waves curl foamy fingers towards the rocks, smash their delicate salt bones to glass. Everywhere is a fine damp mist.
The girl has no book to hand. She pulls back the left sleeve of her raincoat, dips her fingers into a tidal pool, lifts a mixture of sand and clay from it, and tries to draw a map on her skin.
It is not thick enough; the wet sand will not make lines, only prickle her as it winds its way along her forearm. She pulls her sleeve back down. She looks out at the sea, at the gulls mewling, the crows cawing, and tries to think of a song.
A boy approaches the rock on which she sits. He looks up at her.
She looks down at him.
He wears a raincoat too, grey as the sea, and a dark blue scarf around his neck to keep the damp from his throat. It is sensible; she does the same. They look at each other a long moment.
Then he says, “Would you like to hear a story?”
She nods.
“It is said that once every five hundred and sixty-three days, two people will walk on the beach with matching raincoats. It is further said that every one thousand one hundred and twenty-six days, these people will have matching shoes. But it is rare as a bird with feathers linen-smooth, rare as a city on the dark side of the moon, that they will both wear books around their necks, and rarer still that those books will hold secrets.”
“Come up,” whispers the girl to the boy with a book around his neck. “Come up here.”
He does, with his hands to the rock, his shoes like hers, his coat like hers. He unbuttons the collar, unwinds the scarf from his neck. There is a book there, the same length and width as hers, black cord threaded through its sewn leather spine, knotted shut. He reaches for the knot with slender fingers.
“Wait,” she says, “wait.” She unbuttons her collar, unwinds her scarf, bares her own book for the opening, bites her lip as she looks at him. “Are you sure?”
“I want to tell you a secret,” he says, firm.
They open their books. They turn every page as if touching each other’s cheeks. They read the same word, the only word, buried in each book’s deepest heart, nestled up against its sewn leather spine, behind its knotted ribs.
When the tide comes in, it finds a clutch of soft grey feathers sticking to the rocks, spilling from the pages of two tiny books with no words in them. The tide yawns; it licks them like a cat; it tangles the black cord that threads them, knots them together, and swallows them into the sea.
THE PHILOSOPHERS
Adam Ehrlich Sachs
Adam Ehrlich Sachs published his debut collection, Inherited Disorders: Stories, Parables & Problems, featuring 117 short stories and vignettes about the often strange relationships between fathers and sons, in 2016. He studied atmospheric science at Harvard, where he wrote for the Harvard Lampoon. He lives in Pittsburgh, Pennsylvania.
“The Philosphers” was originally published in the New Yorker, before being included in his debut collection. It comprises three of Sachs’s off beat stories about fathers and sons.
Our System
A philosopher had spent his lifetime pondering the nature of knowledge and was ready at long last to write down his conclusions. He took out a sheet of white paper and a pen. But he noticed, upon lifting the pen, a slight tremor in his hand. Hours later he was diagnosed with a neuromuscular disorder that promptly began ravaging his body, though apparently, according to the doctor, not his mind.
He lost the use of his muscles one by one, first in his fingers, then in his toes, then in his arms, then in his legs. Soon he could only whisper weakly and flutter his right eyelid. Just before losing his power of speech entirely, he designed with his son’s help a system by which he could communicate, through twitches and blinks, the letters of the alphabet.
Then the philosopher fell silent.
He and his son embarked upon the writing of his book on knowledge. The father blinked or twitched his right eye; the son wrote down the corresponding letter. Progress was extraordinarily slow. After twenty years, they had written a hundred pages. Then, one morning, when the son picked up the pen, he noticed a slight tremor in his hand. He was diagnosed with the same neuromuscular disorder as his father—it was, naturally, hereditary—and began losing the use of his muscles, too. Soon he could only whisper weakly and manipulate his tongue. He and his own son designed a system by which he could communicate, by tapping his teeth with his tongue, the letters of the alphabet, and then he, too, fell silent.
The writing continued, though the pace, already indescribably slow, slowed even further. The grandfather blinked or twitched his right eyelid, his son tapped a tooth with his tongue, and the grandson wrote down the corresponding letter. After another twenty years, they had written another ten pages on the nature of knowledge.
One morning, the grandson noticed a slight tremor in his hand. He knew instantly what it meant. He didn’t even bother getting the diagnosis. His final surviving muscle was his left eyebrow, and by raising or lowering it just so he could communicate letters to his son. Again the pace slowed by an order of magnitude. The opportunities for error multiplied. Then his son was stricken, then his son’s son, then his son’s son’s son, and then his son’s son’s son’s son, who is my father.
We cram into our ancestral sickroom. It is dark and cold: we keep the blinds lowered and the heat down owing to our hereditary light sensitivity and our hereditary heat intolerance, both of which are in fact unrelated to our hereditary neuromuscular disorder. Someone tries to cough but cannot. I sit at the desk and await the next letter, which can take months to arrive. The philosopher blinks or twitches his right eyelid; his son taps a tooth with his tongue; his son raises or lowers his left eyebrow; his son sucks on his upper or lower lip; his son flares a nostril; my grandfather blinks or twitches his left eyelid; my father taps a tooth with his tongue; and I write down the letter. In the past eleven years I’ve written down the following: CCCONCEPPTCCCCCAAAAACCCCCCCCCCPPCCCCCCPCCCCCCCPCCCCCCC
What to make of this? Perhaps the philosopher has lost his mind. Perhaps there’s been a disruption in our system of twitches and blinks and tooth-tapping and lip-sucking by which a letter is transmitted from his head to my pen. Perhaps—I certainly don’t rule this out!—I have lost my mind: perhaps no matter what my father taps I see only “C”s, and the occasional “P.” Or perhaps our system works perfectly, our philosopher’s mind works perfectly, his theory of knowledge reaches the page just as he intends it, and I simply do not have the wherewithal to understand it. That, too, cannot be ruled out.
A letter is now coming my way. The old men grimace and suck, twitch and tap, blink and blow. My son, here to watch, looks on with pity and terror, still not sure how all this relates to him. He hates being in this room. You should see how eagerly at the end of the day he kisses his ancestors and races out ahead of me into the hall.
Two Hats
The son of the late philosopher-mystic Perelmann, who was writing a biography of his father, used to say at our weekly brown-bag colloquiums that he wore two hats: that of Perelmann’s son and that of his biographer. We assumed that this was just a figure of speech until a graduate student who happened to be renting an apartment across the street from him told us that he really wore two physical hats: the son-of-Perelmann hat was a Boston Red Sox cap, and the biographer-of-Perelmann hat was a brown fedora. Some evenings he wore the Red Sox cap, some evenings he wore the brown fedora, and some evenings he went back and forth, more or less rapidly, between the cap and the fedora.












