The kiribati test, p.3
The Kiribati Test,
p.3
We reached a cabana at the very back, the highest one up on the hillside. The building was completely made of glass. G.J. removed a remote control from his pocket and pressed a button. There was a pneumatic hiss, and a door emerged from the wall and then opened.
I was impressed.
There was a king-sized bed inside, a hot tub, a table set with food and baskets, flowers, a spacious open-air bathroom toward the back with a separate shower and Jacuzzi tub, a huge washbasin sink and wrap-around mirrors. The lighting inside was nice, and the carpet was a kind of fabric as smooth as suede. From inside the cabana, we could see in all directions outside of the building, but I felt a sense of total privacy. I realized no one could see through the glass from the outside.
G.J. stood in the doorway. “If anything is not to your liking, you can just pick up the blue phone and someone will bring it to you.”
I looked at a blue phone on one wall. Written in neat font on a little placard above the phone were the words Blue Phone.
“Bring what to us?” Sara said. She touched the linen on the bed.
“Anything you like, Sara Connors,” G.J. said. “Anything at all.”
He smiled and saw that we were skeptical, yet pleasantly surprised.
“You’ve got three hours before noon,” G.J. said. “I’ll come back for you then. We’ll have lunch. I’ll explain everything then.”
“You will?” I said, looking around the cabana.
G.J. smiled and stepped away from the door. He pressed the remote. There was a pneumatic hiss, and the door sealed shut.
VII
“What is memory?” G.J. Putnam said.
We were seated in a well-lighted garden-area café in an inner courtyard of one of the main buildings. There was a waterfall and abundant natural light, green plants, and the occasional twitter of a bird in the high, open-air ceiling.
“It’s the things you remember,” Sara said. “Experiences, tastes, feelings, emotions. I remember going to the Grand Canyon with Karl. Is that what you mean?”
G.J. smiled and said, “That is precisely what I mean.”
“What does this have to do with us?” I said.
He looked into my eyes, and he frowned thoughtfully.
“There used to be a saying, ‘A penny for your thoughts.’ What if I told you, Sara and Karl, we here at Nano Tech are prepared to pay quite a great deal more than that for yours?”
“For our thoughts?” Sara asked.
G.J. nodded his head.
“What do you mean?” I asked.
“Come,” he said. “I want to show you something.”
We stood up from the table and proceeded across the garden café area. We entered an interior hallway that was clean and artificially lighted. The carpet was very short and grayish white, and there were shiny silver doors on either side of the hallway. There were several windows along the hallway that gave onto interior lab rooms.
We saw lab techs peeking through microscopes; others were testing a man on a treadmill; we passed one lab room with cages of blue parrots and cages of chimpanzees. There was a pool room with dolphins and lab technicians in white lab jackets. It all seemed very warm and friendly.
“One of the fundamental problems with memory,” G.J. said, “is that we are currently living and creating new memories. Right this moment, we are experiencing life”--he looked at Sara and smiled warmly--“and our brain is constantly filtering new material, seeing where and if it fits with old memory, assimilating and creating memory on top of memory like a complex tapestry of sights, sounds, tastes, emotions, and experiences. But on a fundamental level, there is no such thing as ‘the past’. It truly does not exist. And this is on a quantum level, at the core of reality. There is no such thing as the past; it just doesn’t exist. And yet our past experience absolutely forms who we are as individuals.”
Sara said, “So to the human mind--”
“The past is very real,” G.J. said. “But in this physical world, indeed in reality, there is no such thing as ‘past.’ We look at a present condition, whether it’s ancient ruins of a coliseum or background radiation at the edge of the universe, and we can reason through the clues to form a picture of what happened one hundred years ago or ten billion years ago. But, in truth, a condition of ‘past’ -- it just simply doesn’t exist.”
“Except in our minds,” I said, “in the form of memories.”
G.J. looked at me and nodded his head encouragingly. “Now, you’re getting it,” he said.
We came to a silver door.
“Here we are,” G.J. said.
We entered the room. There were a half dozen lab techs in the room, and there were three banks of computers. Along one wall, there were about a dozen visual control displays. And in the center of the room were what looked like two dentist chairs interconnected by a phone booth.
The chairs’ backs faced one another, but in between them, there was a large clear volumetric box about nine feet tall. There were hundreds of cables and wires connecting the chairs to the tall, clear box, which was about the shape of a phone booth from the turn of the century.
“What is that?” I said.
“That,” G.J. Putnam said, “is EDU-102.”
Two of the lab techs looked up at us and smiled.
“What the hell is that?” I said.
“The Experience Display Unit version 102,” G.J. said. “Our scientists here at Nano Tech realized more than a decade ago that electronic signals coursing through the human brain could be broken down into basic DNA units. Each thought we have can be recorded by our data processors as a series of four interacting base elements.”
“Okay,” Sara said.
G.J. said, “What is fascinating is that we’ve found that the human brain constantly creates new series of base elements. You may have a string of thoughts that is recorded TGAC, CTAG, TACG. The string that occurs in one synaptic firing -- a moment that may last only 0.5 milliseconds -- creates a code string of five billion individual units. And through our technology we are able to record that string, in essence capturing a moment of human thought like a fingerprint on a window pane.”
“So, what does it do?” Sara said.
“Well,” he said. “I’ll show you.”
One of the lab technicians helped him up into the chair. Another lab tech fitted a circular ring around his head. He smiled at us.
“If you simply want to watch,” he said. “You can stand there and see my thoughts as represented inside EDU-102. But if you want the real experience, step inside.”
“I think I’ll stay right here,” I said.
“Fair enough,” G.J. said. “I should say, though, that one of the biggest challenges we met with in representing human thought was that thought transmits experiences that incorporate all of the five senses. Ten years ago, there was no machine to transmit taste, smell, and touch. We had televisions and speakers, of course, but nothing to transmit the other three senses. If you step inside EDU-102, you can go for the total ride.”
Sara and I stayed put.
G.J. Putnam gave the signal to a lab tech, and suddenly the EDU-102 unit lit up with an image of us standing there in front of Putnam. We were seeing what he was seeing.
The image of Sara and I inside the unit was quite different than the way I envisioned myself. I looked happier, brighter, more alive. Sara looked ten years younger, sexual, very attractive. We were seeing ourselves as G.J. Putnam saw us right that moment.
And as I smiled in reality, the image inside the unit smiled. We were seeing ourselves through Putnam’s eyes.
He turned and said to one of the lab techs, “Can you filter out the background noise a little more?”
Inside the unit, we saw an image of the lab tech, as Putnam saw him; the lab tech nodded his head. The technician shifted bars on an equalizer, and the distortion of the image inside EDU-102 minimized, and everything became more crisp and clear.
“Okay, that’s pretty cool,” I said.
G.J.’s head pivoted around, and he smiled. And at that moment, the image of me inside EDU-102 brightened and looked more handsome.
G.J. said, “Say something mean and nasty.”
“What do you mean?”
“Anything,” he said. “But try and be truthful.”
I said, “I hate you. I hate that you said that I can’t provide for Sara. And I hate even more that you might actually be right. I hate this entire system that holds people like me down. I could kill you with my bare hands and not a person in here could stop me.”
Sara and I watched as the image of me inside the unit changed. The lines around my eyes became darker and more brooding. For a moment, there was a flash where I looked crazed, my teeth and eyes frightening.
G.J. smiled affably, nodded to a lab technician, and then removed the ring from around his head. The image inside EDU-102 vanished. He stood up and waved us over to a bank of computers along one wall. He put his hand genially on one of the seated lab tech’s backs.
“Every thought I just had,” he said, “was recorded here in individual coded units.”
He pointed at one line on the computer screen.
CTAGTGCATAACTCCGCCTGAGTTACGTACACAGTCCGTATTCGAGTTCAACTGACTGGTACAG
“This line is just one in a huge string,” he said. “The string of individual coded units for that two-minute period of thought is so long that if we printed it up on normal sheets of paper, it would take up more shelf space than an entire public library.”
“In just two minutes?” Sara said.
G.J. looked at her and nodded thoughtfully. “In just two minutes,” he said. “But this code can be recorded. Play it back for us, Sam.”
The lab tech rewound the image. We all turned and watched EDU-102. It rewound through everything we had just seen. Sam pressed “stop” and then “play,” and everything that G.J. Putnam had experienced while in the chair played for us.
“I want to try it,” Sara said.
Putnam beamed.
“And that’s just the beginning of it,” he said. “One of the most interesting advances that we’ve developed in the past year is cortical transfer.”
“What is that?” I said.
“Well, essentially what we do is, we take a lengthy code from one person’s brain, and we transmit it into another person’s brain.”
“I don’t understand,” I said.
“What happens?” Sara said.
G.J. Putnam smiled. His eyebrows rose up excitedly. He said, “Well, for a time you can see the world as another human being.”
“You mean we can see what they see?” I said.
“Oh, it’s more than that, Karl,” G.J. said. He looked at Sara and said, “How many times, Sara, have you wished that Karl here could feel what you were feeling, could know your pain, your joy, your sadness, could know the unique way that you appreciate a particular fragrance, or a gesture that someone makes.”
“You’re telling me we can do that?” Sara asked.
“Our data processors are capable of storing almost forty-five minutes worth of coded sequence,” G.J. said. “Sara, for forty-five minutes, you could be Karl.”
“I would still be me, though,” Sara said.
“Physically, yes,” Putnam said. “But mentally -- dare I say spiritually -- you would be another person. Within a year, we’ll be able to double the amount of coded sequence we can process, which means, for ninety minutes you could experience the world as someone else. And if technology keeps developing as it has been, five years from now, you could experience being someone else for a day, maybe even as much as a week.”
Sara and I just stood there speechless.
Finally, Sara said, “What are the practical applications for something like this?”
“Well, they’re numerous,” he said. “Nano Tech is interested primarily in commercial entertainment. But there are countless practical applications outside of the entertainment industry.”
“Commercial entertainment?” Sara said.
“Imagine spending an evening with a loved one as that loved one. You could physically make love with your partner as your partner and vice versa. Instead of correcting a child when he or she does something wrong, you could have them see themselves as someone else sees them, literally as someone else.”
Sara and I looked at one another, speechless.
G.J. continued, “The practical applications are almost infinite, from substance abuse treatment, to marriage counseling, to prisoner rehabilitation. If someone could see themselves as others see them, it is my strong belief that we’d go a long way, as a species, toward achieving greater peace and harmony worldwide.”
I waited a minute and then said, “I still don’t understand why we’re here. Why Sara and I? How do we fit into this?”
Putnam looked from me to Sara.
“You have something,” he said. “You have an experience, a memory, the evening you spent last night on the sixty-seventh floor of the Global-Com building. Nano Tech would like to buy that memory.”
VIII
The written contract lay atop the varnished tabletop in Sara’s and my room. We stood there looking at it. Putnam had left us alone in order to think about the deal. Standing there, my eyes went to the blank line in the bottom right-hand corner where I was to sign my name.
“Well, what do you think?” I said.
“I think that’s a hell of a lot of money,” Sara said.
Our eyes both went to the seventh line down in the contract. There was a colon at the end of the line, and centered on the line directly underneath that, was a figure.
$58,000,000.00
I read aloud, “‘To be paid in full for the coded sequence of Karl Jacob Connor’s brain appertaining to the events he experienced on January 22 and January 23, 2058.’ Fifty-eight million dollars.”
Sara stared at the number, too. She said, “I’ve counted the zeros on the left side of that decimal point a half dozen times.”
“What in the world do they want with that memory,” I said, “so much that they’d pay that kind of money?”
“Isn’t it obvious?”
I looked at Sara and shook my head.
“Blackmail,” she said. “If Nano Tech has that memory and threatened to publicize it, they could bring down the governor of the state of Arizona, not to mention a major CEO at a rival company. You know who killed a man, Karl.”
“I don’t know that he killed Earl,” I said.
“Oh, come on,” Sara said.
I shrugged. “Well, I don’t,” I said. “I saw that CEO messing around with three girls. I didn’t see him throw Earl Redgraves off of a building.”
“But that doesn’t matter to Nano Tech,” Sara said. “They could threaten to give your memory to the state attorney’s office. You heard Putnam. This new technology will be admissible in a court of law in two years time. It’s like DNA testing back at the turn of the century, fingerprinting a century before that. Memory Retrieval Presentation, Putnam called it.”
“What do you think would happen to us?” I said.
“We could go to Kiribati,” Sara said. “It’s part of the contract. It says here -- as we asked -- that we’d be offered amnesty in the Republic of Kiribati.”
“We could buy two plane tickets to the middle of the South Pacific, Sara.”
“We could build a home. We could start a family.”
A blue Pilot pen lay on the table beside the contract.
“Fifty-eight million dollars,” I whispered.
I looked at Sara, then at the paper, and I felt my pulse beating hard in my chest. Sara smiled nervously.
I took the pen in my hand, leaned over the table, and signed my name on the contract.
IX
“Memory Retrieval is slightly different than the Experience Display you saw earlier today,” G.J. Putnam said.
It was late in the afternoon, and the energy in the lab room with EDU-102 seemed lethargic. One of the lab techs yawned and leaned back in his chair. He ran his fingers through his hair and stared listlessly at the computer screen.
For Sara and I, it was a completely different experience. The realization that I was about to undergo a procedure whereby these scientists would be able to read my mind was exciting. More exciting still was the realization that following the procedure Sara and I would be multi-millionaires and that I could quit my job, that she could quit her job, that we could begin a family.
“It is more electrically invasive,” Putnam said.
“What does that mean?” I asked.
“Well, it just means that we have to go in,” Putnam said.
“Go in?” Sara said.
“Into Karl’s brain,” Putnam said. “Specifically, we will be traveling deep into your temporal lobe, Karl, to a region known as the hippocampus.”
I asked, “What does the hippocampus do?”
“That’s a great question,” Putnam said. “The hippocampus is the area of the brain where new memories are formed. Through hundreds of experiments, we’ve learned that subjects with damaged hippocampi have great difficulty forming new memories. Alzheimer patients, for instance, show a deterioration of synaptic firing in the hippocampus. The hippocampus is essential in processing, storing, and creating new memories. It’s also closely related to our emotions.”
“How so?” I asked.
“Well, emotion and memory are closely linked,” Putnam said. “You tend to remember more emotional moments in your life better than the bland day-to-day moments. And again, here, the hippocampus steps up to the plate. It is essential in regulating and processing emotional stimuli. In manic patients, we see increased synaptic firing in the hippocampus; whereas in depressive patients, we see lower synaptic firing in the hippocampus. Likewise in manic-depressive patients, we see wide fluctuations in conjunction with regulatory problems in that very same region.”
“The hippocampus,” Sara said.
“Perhaps of interest, too,” Putnam said, “is the realization that schizophrenia occurs when there is shrinkage of the hippocampus.”


